ID: 1016054462

View in Genome Browser
Species Human (GRCh38)
Location 6:139565268-139565290
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016054458_1016054462 16 Left 1016054458 6:139565229-139565251 CCCTCACTTTCCTCTAAACAAAC No data
Right 1016054462 6:139565268-139565290 TAGCTGTGTTGCCTATAGCTGGG No data
1016054459_1016054462 15 Left 1016054459 6:139565230-139565252 CCTCACTTTCCTCTAAACAAACA No data
Right 1016054462 6:139565268-139565290 TAGCTGTGTTGCCTATAGCTGGG No data
1016054460_1016054462 6 Left 1016054460 6:139565239-139565261 CCTCTAAACAAACAGAATCTCTC No data
Right 1016054462 6:139565268-139565290 TAGCTGTGTTGCCTATAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016054462 Original CRISPR TAGCTGTGTTGCCTATAGCT GGG Intergenic
No off target data available for this crispr