ID: 1016054843

View in Genome Browser
Species Human (GRCh38)
Location 6:139567520-139567542
Sequence AGGAAGAGCACAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016054843_1016054849 25 Left 1016054843 6:139567520-139567542 CCCACAATCACTGTGCTCTTCCT No data
Right 1016054849 6:139567568-139567590 TGTGCCATGCAGCCACTGCCAGG No data
1016054843_1016054850 26 Left 1016054843 6:139567520-139567542 CCCACAATCACTGTGCTCTTCCT No data
Right 1016054850 6:139567569-139567591 GTGCCATGCAGCCACTGCCAGGG No data
1016054843_1016054851 27 Left 1016054843 6:139567520-139567542 CCCACAATCACTGTGCTCTTCCT No data
Right 1016054851 6:139567570-139567592 TGCCATGCAGCCACTGCCAGGGG 0: 3
1: 6
2: 34
3: 72
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016054843 Original CRISPR AGGAAGAGCACAGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr