ID: 1016063120

View in Genome Browser
Species Human (GRCh38)
Location 6:139650830-139650852
Sequence CCTTATCTTTACAATGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016063117_1016063120 -8 Left 1016063117 6:139650815-139650837 CCATGGGTTTTAGTTCCTTATCT No data
Right 1016063120 6:139650830-139650852 CCTTATCTTTACAATGTGGTTGG No data
1016063114_1016063120 23 Left 1016063114 6:139650784-139650806 CCTGGGCTACATGGCTATGAACT No data
Right 1016063120 6:139650830-139650852 CCTTATCTTTACAATGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016063120 Original CRISPR CCTTATCTTTACAATGTGGT TGG Intergenic
No off target data available for this crispr