ID: 1016066959

View in Genome Browser
Species Human (GRCh38)
Location 6:139693796-139693818
Sequence CACTTTCACCTGAAGTAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016066959_1016066963 10 Left 1016066959 6:139693796-139693818 CCCCACTACTTCAGGTGAAAGTG 0: 1
1: 0
2: 1
3: 17
4: 151
Right 1016066963 6:139693829-139693851 TTGAATTACTTAGCTAATTGAGG 0: 1
1: 0
2: 0
3: 10
4: 173
1016066959_1016066964 27 Left 1016066959 6:139693796-139693818 CCCCACTACTTCAGGTGAAAGTG 0: 1
1: 0
2: 1
3: 17
4: 151
Right 1016066964 6:139693846-139693868 TTGAGGACAAAGCACAGTTTTGG 0: 1
1: 0
2: 0
3: 21
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016066959 Original CRISPR CACTTTCACCTGAAGTAGTG GGG (reversed) Intergenic
904909196 1:33921489-33921511 CAGTTCCACCTGGTGTAGTGAGG - Intronic
905241140 1:36582338-36582360 CACTTTCCACAGAAGCAGTGGGG - Intergenic
906248087 1:44291099-44291121 CAATTTAACCCGAATTAGTGAGG + Intronic
906615894 1:47232445-47232467 CAATTTCACCGGAGGGAGTGGGG + Intergenic
912515311 1:110213107-110213129 CCCTTTCACCTAAAGGAGTTAGG - Intronic
916816193 1:168355104-168355126 CAGTTTCACGTCAGGTAGTGTGG + Intergenic
917306148 1:173627638-173627660 CACTTTAGCCTGTAGTGGTGGGG - Intronic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
917937648 1:179883655-179883677 CACTGTAACCTCAAGTAGTCTGG + Intronic
918286487 1:183060263-183060285 CATTTTCATCTTAAGTAGTATGG + Intronic
921823720 1:219647500-219647522 AACTTAGACCTGAAGTAGAGGGG - Intergenic
1065298722 10:24301607-24301629 CACTTTCAGCTGAAGTGATCTGG - Intronic
1068493284 10:57751375-57751397 CACCTTCAGCTGAAGTATTCAGG - Intergenic
1071924747 10:90393044-90393066 CACACTCACCTGAAATACTGAGG + Intergenic
1075119533 10:119654495-119654517 CGCCTTCTCCTGAAGTAGTTAGG + Intronic
1075298749 10:121301246-121301268 CACTTTCTGCTGAAATAGAGGGG + Intergenic
1082612402 11:55317110-55317132 CAGTTTTAGCTGAAGCAGTGTGG + Intergenic
1083225252 11:61280931-61280953 CACCTCCCCCTGAAGGAGTGAGG + Exonic
1086742119 11:90380556-90380578 CACCTTCAACTGAAATATTGAGG - Intergenic
1088335998 11:108704582-108704604 CACTAGCACATGAAGCAGTGAGG - Intronic
1088960755 11:114662406-114662428 CACTTTAGCCTGCAGCAGTGAGG - Intergenic
1090221027 11:125026199-125026221 CACTTTCGCCTGTGGTGGTGAGG + Intronic
1090450346 11:126800674-126800696 CCCTTTCAGCTGCATTAGTGAGG + Intronic
1090859504 11:130640418-130640440 CATTTTAACCTGGAGAAGTGGGG + Intergenic
1094204701 12:27827983-27828005 CACTGTCACCTGCAGTTATGTGG - Intergenic
1097109059 12:56644629-56644651 CAGTTTCACCTGAAGAAATTAGG - Intronic
1098673888 12:73265632-73265654 CACCTTCATCTGAAGTATTCAGG + Intergenic
1098676539 12:73295930-73295952 CAGTTTCACCTGAACTTTTGTGG + Intergenic
1100370369 12:93963961-93963983 TACTGTCACCTGCAGTATTGTGG - Intergenic
1100731649 12:97477406-97477428 CACTGTCACCTGGATTATTGTGG - Intergenic
1101080331 12:101174784-101174806 TACCTCCACCTGAAGTAATGAGG + Intronic
1104751520 12:131243011-131243033 CACTTGCCCCTGAAGGAGAGTGG - Intergenic
1106817429 13:33424189-33424211 CAATTTCAACTTAAGTAGTCTGG - Intergenic
1109023482 13:57130074-57130096 CACTTTTTCCTGGAGTAGTTAGG + Intergenic
1110383637 13:74882896-74882918 CAACTTCTTCTGAAGTAGTGGGG + Intergenic
1111101896 13:83598579-83598601 CACTTTCACCTGAAACATTCAGG - Intergenic
1112398021 13:99051130-99051152 CACTGTCACCTGAAGCAATGGGG + Intronic
1114432100 14:22670590-22670612 CACTTTAGCCGGCAGTAGTGAGG - Intergenic
1114985226 14:28218033-28218055 CATTTTGACCTGTAGTGGTGAGG + Intergenic
1121966181 14:98308080-98308102 CTCTTTCACATGAAGTAAGGTGG + Intergenic
1124064339 15:26326206-26326228 AACTTTCACCTTAAGAATTGAGG + Intergenic
1126153761 15:45546540-45546562 CACTTAAACCTGAGGTAGGGAGG - Intergenic
1126183684 15:45810502-45810524 CACTTTAGCCTGCAGTGGTGAGG - Intergenic
1127155857 15:56123700-56123722 CACTTTAGCCTGCAGTGGTGAGG + Intronic
1127264406 15:57349890-57349912 CATTTGCACCTGAAGTAGGTAGG + Intergenic
1128360364 15:66957449-66957471 CTATTTCACCTGGAGTAGGGAGG + Intergenic
1129297706 15:74608977-74608999 CACCTTCTCCTGAAGTAGCCAGG + Intronic
1131590745 15:93746392-93746414 CACCTTCAACTGAAGTACTCAGG + Intergenic
1136384667 16:29916096-29916118 CACTGTCTCCTGCATTAGTGTGG - Intronic
1137650175 16:50113350-50113372 CACTTTCACCTTAAATAATAAGG + Intergenic
1137870193 16:51942887-51942909 CACATCCACCTTAAGCAGTGGGG + Intergenic
1138147001 16:54621727-54621749 TAATTTCACCTGAAGAAATGGGG - Intergenic
1142049029 16:87946003-87946025 CACTTTCAGATGAAGTAGGTGGG + Intergenic
1145995886 17:29104728-29104750 CACTTGCCCCTGAAGTAAAGAGG - Intronic
1156317244 18:35981579-35981601 CACTTGCAAATGAAGTAATGTGG - Intergenic
1156714619 18:39992363-39992385 CACTTTCACCTGATATAGTCAGG - Intergenic
1158969945 18:62656978-62657000 CACTTTCAGGTGAATCAGTGAGG - Intergenic
1159734403 18:72076116-72076138 CACTTTACCCTGATGAAGTGAGG + Intergenic
1164477604 19:28587211-28587233 CACTTTCACTTGAGGTAGTCAGG + Intergenic
926438278 2:12859831-12859853 CACTGTCACCTGAAGTTATGTGG + Intergenic
926975478 2:18512593-18512615 CAATTTCAGCTTAAGTAGTGTGG - Intergenic
928737305 2:34307022-34307044 TACTTCCACCTGAAGTCATGGGG + Intergenic
929663583 2:43815215-43815237 CAGTTTCACCTGAAATAGATTGG - Intronic
932007527 2:67941615-67941637 CACTGTCACCTGTAGTAATGTGG + Intergenic
936521673 2:113215630-113215652 CACTTTCACCTGGGGTAGGGAGG - Intergenic
937621817 2:123997139-123997161 CACTTTCACGTGGAGAAGAGAGG - Intergenic
937739390 2:125332786-125332808 CACTTTAGCCTGTGGTAGTGGGG - Intergenic
938149676 2:128871346-128871368 CATTTTCACCTGGAAAAGTGTGG - Intergenic
940627406 2:156192637-156192659 CACTTTCACTTGAAGAAATGAGG - Intergenic
941540109 2:166771726-166771748 CCCATTCACCTGGAGTAGTTGGG + Intergenic
944855185 2:203760343-203760365 TACTTTAGCCTGAAGTGGTGGGG + Intergenic
945598414 2:211826161-211826183 CATTTTGAAATGAAGTAGTGTGG + Intronic
948565593 2:238884298-238884320 CACCTTCACCTGGAGAAGTGAGG + Intronic
1168780390 20:484224-484246 CACTTTAACTTGAATTTGTGAGG - Intronic
1184393031 22:44216354-44216376 CACTTTCACTTGAAGTTCTCCGG + Intronic
951423031 3:22510281-22510303 CACTTTAGCCTGTAGTAGTGAGG - Intergenic
951538425 3:23760682-23760704 CACTTTGGCCTGCAATAGTGAGG - Intergenic
952672942 3:35993334-35993356 CACTTTGGCCTGTGGTAGTGAGG - Intergenic
953432928 3:42854507-42854529 CACTTCCACCTCACGTTGTGAGG + Intronic
954352697 3:50058429-50058451 CACTATCACCTCAGGTGGTGTGG - Exonic
957126877 3:76172734-76172756 CACTTTTACCTCATGAAGTGTGG - Intronic
959118587 3:102206714-102206736 TACTTTAGCCCGAAGTAGTGAGG + Intronic
960268169 3:115645356-115645378 AGCCTTCACTTGAAGTAGTGAGG + Intronic
964829008 3:160862299-160862321 CACTTTCAACTGAAGGGGTGAGG - Intronic
966704044 3:182891169-182891191 CACTTCCACCTGAAATAGTGGGG + Intronic
970799824 4:19959470-19959492 CACCTTTACCTGTAGTAATGTGG + Intergenic
971227178 4:24765353-24765375 AACTATCACCTGCAGTAATGTGG - Intergenic
971992765 4:33921806-33921828 CACTTTGAACTGGAGTAATGGGG - Intergenic
974284699 4:59848730-59848752 CACTTTCACCTGATTGAATGAGG + Intergenic
974771709 4:66423279-66423301 CACTTTCACTCTCAGTAGTGGGG - Intergenic
975196360 4:71529443-71529465 CACTATCTCTTGGAGTAGTGTGG + Intronic
976034872 4:80805344-80805366 CACTTTCCTCTGAAGTTTTGTGG - Intronic
977826889 4:101543029-101543051 CAGTGTCTCCTGAGGTAGTGTGG - Intronic
981049353 4:140295364-140295386 CACATTCACATGGAGTGGTGGGG - Intronic
981895565 4:149795455-149795477 CACTTTAGCCTGCAGTGGTGAGG - Intergenic
982775364 4:159436049-159436071 CACTTTCACCTCAGGTAGAGAGG - Intergenic
982894326 4:160898136-160898158 AAATTTCACCTGAATTAGTTTGG + Intergenic
987163886 5:15173883-15173905 CACTTTATCCTGCAGTGGTGAGG - Intergenic
987639180 5:20589532-20589554 CACTGTCACCTAAAGTAATAGGG - Intergenic
990899860 5:60738723-60738745 CACTTTAACCTGCAGTGGCGAGG - Intergenic
993267909 5:85751172-85751194 CACTGTCACCTGCAGTAATGTGG - Intergenic
994206690 5:97043765-97043787 CAGTTTCAGCTGGACTAGTGTGG + Intergenic
999644113 5:153701113-153701135 CACCTTCACCTCATGTAATGTGG + Intronic
1000690854 5:164319225-164319247 CCCTATCACTTGAAGTATTGGGG - Intergenic
1007360202 6:41350040-41350062 CACTGTCATCTGCAGTAATGTGG - Intronic
1007642581 6:43354549-43354571 CTCTTTCACTTGAAGTCGTCTGG - Intronic
1013304858 6:108838561-108838583 CACTTGCAGCTGCGGTAGTGAGG + Intergenic
1014458001 6:121660297-121660319 TATTTTCACATGAAGTACTGTGG - Intergenic
1014794624 6:125710478-125710500 CACTTTAGCCTGCAGTGGTGAGG - Intergenic
1015455018 6:133416750-133416772 CAATTTCACATCAAGGAGTGTGG - Intronic
1016066959 6:139693796-139693818 CACTTTCACCTGAAGTAGTGGGG - Intergenic
1018402931 6:163443994-163444016 CACTTGCTCTTGAAGAAGTGGGG - Intronic
1020070765 7:5225553-5225575 CACTTTTAGCTGAAGTAGGATGG - Intronic
1020077814 7:5270097-5270119 CACTTGGAACTGAAGGAGTGTGG - Intergenic
1022223680 7:28340767-28340789 CACTTTAGCCTGCAGTGGTGAGG + Intronic
1022405284 7:30084060-30084082 CAATTTCACATGAGGTAGTTGGG - Exonic
1024705933 7:51959610-51959632 CACTTTACCCTGCAGTGGTGAGG + Intergenic
1025201072 7:56962074-56962096 CACTTGGAACTGAAGGAGTGTGG + Intergenic
1025670872 7:63614858-63614880 CACTTGGAACTGAAGGAGTGTGG - Intergenic
1028027584 7:85866351-85866373 CACCTTCAGCTGAAGTATCGGGG + Intergenic
1028056560 7:86252520-86252542 CCCTGAAACCTGAAGTAGTGTGG - Intergenic
1028207645 7:88034667-88034689 CACTTTAGCCTCAGGTAGTGAGG + Intronic
1028880256 7:95872088-95872110 CACTTTCACCTGCTGTGGGGAGG + Intronic
1029361501 7:100091562-100091584 CACTTTCACGTGCAGGACTGGGG + Intronic
1030849723 7:114468427-114468449 CAATGTCACCTTAAGTAGTTTGG - Intronic
1031846290 7:126809124-126809146 CACTTTCAAAAGAAGCAGTGGGG + Intronic
1032022715 7:128418763-128418785 CACTATCAACTGGAGTAGTCAGG + Intergenic
1033814096 7:145051477-145051499 CACTTTAACCTGTGGTGGTGGGG + Intergenic
1033903095 7:146167374-146167396 AACTTTCAGCTGAAGTATTGTGG - Intronic
1034003538 7:147443151-147443173 CACTTTAGCCAGCAGTAGTGAGG + Intronic
1034126307 7:148674986-148675008 CACTTTTGCCTGCAGTGGTGGGG - Intergenic
1034523256 7:151637363-151637385 CAATTTCACCTGTAATCGTGAGG + Intronic
1037295539 8:17396592-17396614 CACTTTAGCCTGCAGTAGTGAGG - Intronic
1037317599 8:17613534-17613556 CAGTCTCCCGTGAAGTAGTGGGG + Intronic
1038608797 8:29039465-29039487 CACTTTCTCCTGAGATAGTCTGG + Intronic
1040464355 8:47680119-47680141 CACTTTCCCTTAAATTAGTGAGG - Intronic
1040912108 8:52529617-52529639 CACTTTCTGCTAAAGAAGTGTGG + Intergenic
1042185663 8:66134426-66134448 CCTTTTCACCTGAAGAAATGAGG - Intronic
1043338743 8:79210568-79210590 CATTTTCACCTGAACTATTTTGG - Intergenic
1044150341 8:88769125-88769147 GTCTTTCACATGAAGTAGTATGG + Intergenic
1046290323 8:112150752-112150774 CATTTTTAACTGAAGTACTGAGG + Intergenic
1046354534 8:113063746-113063768 AACTTACACCTGAAGTAGATAGG - Intronic
1047030000 8:120866343-120866365 CTCTATCACCTGCAGTTGTGTGG + Intergenic
1048195405 8:132328087-132328109 CATGTTCACCTGAACCAGTGAGG + Intronic
1050460035 9:5869772-5869794 CACTTTGACCTCAAGGAGTTGGG + Intergenic
1051427046 9:16942751-16942773 TACTTTTACTTGAAGTTGTGAGG - Intergenic
1051996003 9:23219168-23219190 CACTTACACCTGCAGTACTTTGG - Intergenic
1053052026 9:34969925-34969947 CACTTTGACCACCAGTAGTGTGG + Intronic
1055084659 9:72301653-72301675 CACATTCATCTGAGGTAGTAGGG - Intergenic
1057100027 9:92350203-92350225 CAATTTCAGCTAAAGTAGTCAGG - Intronic
1058376529 9:104328503-104328525 CACTTGCAACTGAAGTATTTTGG + Intergenic
1059552296 9:115241359-115241381 CACTTGAACCTGAAGCAGGGCGG + Intronic
1186602238 X:11050162-11050184 CACTTTAGCCTGCAGTGGTGAGG + Intergenic
1188078610 X:25808392-25808414 CACTTTATCCTGCAGTAGTGAGG + Intergenic
1188421203 X:29992347-29992369 CACTTTGGCCTGCAGTGGTGAGG + Intergenic
1188791333 X:34411701-34411723 CACTTTCAACTGAAGCATTCAGG + Intergenic
1189898736 X:45683625-45683647 CAATTTCACCTGAAGTTTTAAGG - Intergenic
1190448960 X:50558224-50558246 AACTATCAGCTGTAGTAGTGTGG - Intergenic
1191754771 X:64581623-64581645 CACCTTCACCTGAGCTATTGGGG + Intergenic
1191889659 X:65926943-65926965 CACTTTCAACTGAAGTATCCAGG - Intergenic
1193756863 X:85419222-85419244 CAGTTTAGCCTGCAGTAGTGGGG + Intergenic
1195165180 X:102213056-102213078 CACTTTGGCCTGTAGTGGTGTGG + Intergenic
1195193678 X:102474035-102474057 CACTTTGGCCTGTAGTGGTGTGG - Intergenic
1196096855 X:111809285-111809307 CACTTTGGCCTGAGGTGGTGAGG + Intronic
1196510196 X:116500099-116500121 CACTTTAGCCTGTAGTGGTGAGG + Intergenic
1197110757 X:122771525-122771547 CACCTTCCCCAGCAGTAGTGGGG + Intergenic
1197177988 X:123504954-123504976 CACTTTGACCTGCTGTAGTGAGG - Intergenic
1197559637 X:128001818-128001840 CACTGTCACCTGAGGTACTATGG - Intergenic
1197673397 X:129303407-129303429 CACTGTCATCTGAAATGGTGTGG + Intergenic
1199810834 X:151347001-151347023 CACTTCCACCTGGAGTAGCAGGG + Intergenic