ID: 1016070898

View in Genome Browser
Species Human (GRCh38)
Location 6:139737761-139737783
Sequence GTTCTGTTAGTGAAGAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016070895_1016070898 22 Left 1016070895 6:139737716-139737738 CCTGAGGGTGTTTCTTCCTTTTC No data
Right 1016070898 6:139737761-139737783 GTTCTGTTAGTGAAGAAACATGG No data
1016070896_1016070898 6 Left 1016070896 6:139737732-139737754 CCTTTTCTTAAAAAGAAGTCCTG No data
Right 1016070898 6:139737761-139737783 GTTCTGTTAGTGAAGAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016070898 Original CRISPR GTTCTGTTAGTGAAGAAACA TGG Intergenic
No off target data available for this crispr