ID: 1016071326

View in Genome Browser
Species Human (GRCh38)
Location 6:139742470-139742492
Sequence GTCTACCGTTTGTTTTATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016071325_1016071326 5 Left 1016071325 6:139742442-139742464 CCATAGAAGATGCTCGTTAATGA No data
Right 1016071326 6:139742470-139742492 GTCTACCGTTTGTTTTATCCAGG No data
1016071323_1016071326 26 Left 1016071323 6:139742421-139742443 CCTAGCTTTTTCTTTGCCTAACC No data
Right 1016071326 6:139742470-139742492 GTCTACCGTTTGTTTTATCCAGG No data
1016071324_1016071326 10 Left 1016071324 6:139742437-139742459 CCTAACCATAGAAGATGCTCGTT No data
Right 1016071326 6:139742470-139742492 GTCTACCGTTTGTTTTATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016071326 Original CRISPR GTCTACCGTTTGTTTTATCC AGG Intergenic