ID: 1016073364

View in Genome Browser
Species Human (GRCh38)
Location 6:139767785-139767807
Sequence CGGGTTCTGTACGCTTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016073359_1016073364 -1 Left 1016073359 6:139767763-139767785 CCTACAAACATGGCGCTGTACCC No data
Right 1016073364 6:139767785-139767807 CGGGTTCTGTACGCTTTTCCAGG No data
1016073356_1016073364 22 Left 1016073356 6:139767740-139767762 CCACCTATATCAAATAGCTAGTT No data
Right 1016073364 6:139767785-139767807 CGGGTTCTGTACGCTTTTCCAGG No data
1016073357_1016073364 19 Left 1016073357 6:139767743-139767765 CCTATATCAAATAGCTAGTTCCT No data
Right 1016073364 6:139767785-139767807 CGGGTTCTGTACGCTTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016073364 Original CRISPR CGGGTTCTGTACGCTTTTCC AGG Intergenic
No off target data available for this crispr