ID: 1016074268

View in Genome Browser
Species Human (GRCh38)
Location 6:139777514-139777536
Sequence AAACAGTTCCTAAGAGCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016074268_1016074269 17 Left 1016074268 6:139777514-139777536 CCATATGCTCTTAGGAACTGTTT No data
Right 1016074269 6:139777554-139777576 CAGAGAGACAGTATCACCAGAGG No data
1016074268_1016074271 24 Left 1016074268 6:139777514-139777536 CCATATGCTCTTAGGAACTGTTT No data
Right 1016074271 6:139777561-139777583 ACAGTATCACCAGAGGGAATTGG No data
1016074268_1016074273 26 Left 1016074268 6:139777514-139777536 CCATATGCTCTTAGGAACTGTTT No data
Right 1016074273 6:139777563-139777585 AGTATCACCAGAGGGAATTGGGG No data
1016074268_1016074274 27 Left 1016074268 6:139777514-139777536 CCATATGCTCTTAGGAACTGTTT No data
Right 1016074274 6:139777564-139777586 GTATCACCAGAGGGAATTGGGGG No data
1016074268_1016074272 25 Left 1016074268 6:139777514-139777536 CCATATGCTCTTAGGAACTGTTT No data
Right 1016074272 6:139777562-139777584 CAGTATCACCAGAGGGAATTGGG No data
1016074268_1016074270 18 Left 1016074268 6:139777514-139777536 CCATATGCTCTTAGGAACTGTTT No data
Right 1016074270 6:139777555-139777577 AGAGAGACAGTATCACCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016074268 Original CRISPR AAACAGTTCCTAAGAGCATA TGG (reversed) Intergenic
No off target data available for this crispr