ID: 1016074272

View in Genome Browser
Species Human (GRCh38)
Location 6:139777562-139777584
Sequence CAGTATCACCAGAGGGAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016074268_1016074272 25 Left 1016074268 6:139777514-139777536 CCATATGCTCTTAGGAACTGTTT No data
Right 1016074272 6:139777562-139777584 CAGTATCACCAGAGGGAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016074272 Original CRISPR CAGTATCACCAGAGGGAATT GGG Intergenic
No off target data available for this crispr