ID: 1016076233

View in Genome Browser
Species Human (GRCh38)
Location 6:139799371-139799393
Sequence GTGTCAAGTGGGCTGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016076226_1016076233 -3 Left 1016076226 6:139799351-139799373 CCGTAAGTGAGATAATCCCTGTG No data
Right 1016076233 6:139799371-139799393 GTGTCAAGTGGGCTGGTGGAAGG No data
1016076225_1016076233 21 Left 1016076225 6:139799327-139799349 CCTTACTTTAAAAGTTGTTGTGA No data
Right 1016076233 6:139799371-139799393 GTGTCAAGTGGGCTGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016076233 Original CRISPR GTGTCAAGTGGGCTGGTGGA AGG Intergenic
No off target data available for this crispr