ID: 1016079119

View in Genome Browser
Species Human (GRCh38)
Location 6:139834196-139834218
Sequence TTGCCTGCATGTACTAGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016079119_1016079120 -9 Left 1016079119 6:139834196-139834218 CCTGATCTAGTACATGCAGGCAA No data
Right 1016079120 6:139834210-139834232 TGCAGGCAAATTCTTACATGTGG No data
1016079119_1016079124 24 Left 1016079119 6:139834196-139834218 CCTGATCTAGTACATGCAGGCAA No data
Right 1016079124 6:139834243-139834265 ATGGACAAAACCTGGACATTAGG No data
1016079119_1016079123 16 Left 1016079119 6:139834196-139834218 CCTGATCTAGTACATGCAGGCAA No data
Right 1016079123 6:139834235-139834257 GTACATGAATGGACAAAACCTGG No data
1016079119_1016079122 5 Left 1016079119 6:139834196-139834218 CCTGATCTAGTACATGCAGGCAA No data
Right 1016079122 6:139834224-139834246 TACATGTGGTGGTACATGAATGG No data
1016079119_1016079125 27 Left 1016079119 6:139834196-139834218 CCTGATCTAGTACATGCAGGCAA No data
Right 1016079125 6:139834246-139834268 GACAAAACCTGGACATTAGGTGG No data
1016079119_1016079121 -6 Left 1016079119 6:139834196-139834218 CCTGATCTAGTACATGCAGGCAA No data
Right 1016079121 6:139834213-139834235 AGGCAAATTCTTACATGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016079119 Original CRISPR TTGCCTGCATGTACTAGATC AGG (reversed) Intergenic
No off target data available for this crispr