ID: 1016079378

View in Genome Browser
Species Human (GRCh38)
Location 6:139837093-139837115
Sequence ATGTGACAAGGGCCGTCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016079375_1016079378 10 Left 1016079375 6:139837060-139837082 CCTAAAGGCTGAGCAGGAGGACA No data
Right 1016079378 6:139837093-139837115 ATGTGACAAGGGCCGTCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016079378 Original CRISPR ATGTGACAAGGGCCGTCATA AGG Intergenic
No off target data available for this crispr