ID: 1016083342

View in Genome Browser
Species Human (GRCh38)
Location 6:139882050-139882072
Sequence GTGCCTATGTTGACCAGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016083342_1016083351 27 Left 1016083342 6:139882050-139882072 CCTGATCTGGTCAACATAGGCAC No data
Right 1016083351 6:139882100-139882122 GCCTCAGCTGCAGCAGCACCAGG No data
1016083342_1016083346 -5 Left 1016083342 6:139882050-139882072 CCTGATCTGGTCAACATAGGCAC No data
Right 1016083346 6:139882068-139882090 GGCACCAGCTACAGGGCCCTGGG No data
1016083342_1016083345 -6 Left 1016083342 6:139882050-139882072 CCTGATCTGGTCAACATAGGCAC No data
Right 1016083345 6:139882067-139882089 AGGCACCAGCTACAGGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016083342 Original CRISPR GTGCCTATGTTGACCAGATC AGG (reversed) Intergenic
No off target data available for this crispr