ID: 1016085169

View in Genome Browser
Species Human (GRCh38)
Location 6:139904542-139904564
Sequence TTCTAAAAACAGTGGCTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016085167_1016085169 5 Left 1016085167 6:139904514-139904536 CCATGGTTGAGGCACTAAGGAAA No data
Right 1016085169 6:139904542-139904564 TTCTAAAAACAGTGGCTTTAAGG No data
1016085164_1016085169 16 Left 1016085164 6:139904503-139904525 CCAGAACTTCACCATGGTTGAGG No data
Right 1016085169 6:139904542-139904564 TTCTAAAAACAGTGGCTTTAAGG No data
1016085162_1016085169 30 Left 1016085162 6:139904489-139904511 CCTCAATGCAGCATCCAGAACTT No data
Right 1016085169 6:139904542-139904564 TTCTAAAAACAGTGGCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016085169 Original CRISPR TTCTAAAAACAGTGGCTTTA AGG Intergenic
No off target data available for this crispr