ID: 1016086274

View in Genome Browser
Species Human (GRCh38)
Location 6:139919320-139919342
Sequence TGTAGTCCCAGCTACTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 738733
Summary {0: 4222, 1: 106815, 2: 237506, 3: 242608, 4: 147582}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016086274_1016086281 25 Left 1016086274 6:139919320-139919342 CCTCCAGAGTAGCTGGGACTACA 0: 4222
1: 106815
2: 237506
3: 242608
4: 147582
Right 1016086281 6:139919368-139919390 TGTACTTTTAGAAGAGAGATGGG No data
1016086274_1016086280 24 Left 1016086274 6:139919320-139919342 CCTCCAGAGTAGCTGGGACTACA 0: 4222
1: 106815
2: 237506
3: 242608
4: 147582
Right 1016086280 6:139919367-139919389 TTGTACTTTTAGAAGAGAGATGG No data
1016086274_1016086282 26 Left 1016086274 6:139919320-139919342 CCTCCAGAGTAGCTGGGACTACA 0: 4222
1: 106815
2: 237506
3: 242608
4: 147582
Right 1016086282 6:139919369-139919391 GTACTTTTAGAAGAGAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016086274 Original CRISPR TGTAGTCCCAGCTACTCTGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr