ID: 1016086276

View in Genome Browser
Species Human (GRCh38)
Location 6:139919323-139919345
Sequence GCCTGTAGTCCCAGCTACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 789578
Summary {0: 71612, 1: 190254, 2: 237127, 3: 179987, 4: 110598}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016086276_1016086280 21 Left 1016086276 6:139919323-139919345 CCAGAGTAGCTGGGACTACAGGC 0: 71612
1: 190254
2: 237127
3: 179987
4: 110598
Right 1016086280 6:139919367-139919389 TTGTACTTTTAGAAGAGAGATGG No data
1016086276_1016086282 23 Left 1016086276 6:139919323-139919345 CCAGAGTAGCTGGGACTACAGGC 0: 71612
1: 190254
2: 237127
3: 179987
4: 110598
Right 1016086282 6:139919369-139919391 GTACTTTTAGAAGAGAGATGGGG No data
1016086276_1016086281 22 Left 1016086276 6:139919323-139919345 CCAGAGTAGCTGGGACTACAGGC 0: 71612
1: 190254
2: 237127
3: 179987
4: 110598
Right 1016086281 6:139919368-139919390 TGTACTTTTAGAAGAGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016086276 Original CRISPR GCCTGTAGTCCCAGCTACTC TGG (reversed) Intergenic
Too many off-targets to display for this crispr