ID: 1016086277

View in Genome Browser
Species Human (GRCh38)
Location 6:139919351-139919373
Sequence AGTACAAAAAAAAATGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016086277_1016086282 -5 Left 1016086277 6:139919351-139919373 CCACCACCATTTTTTTTTGTACT No data
Right 1016086282 6:139919369-139919391 GTACTTTTAGAAGAGAGATGGGG No data
1016086277_1016086281 -6 Left 1016086277 6:139919351-139919373 CCACCACCATTTTTTTTTGTACT No data
Right 1016086281 6:139919368-139919390 TGTACTTTTAGAAGAGAGATGGG No data
1016086277_1016086283 9 Left 1016086277 6:139919351-139919373 CCACCACCATTTTTTTTTGTACT No data
Right 1016086283 6:139919383-139919405 GAGATGGGGTTTTGCGATATAGG No data
1016086277_1016086280 -7 Left 1016086277 6:139919351-139919373 CCACCACCATTTTTTTTTGTACT No data
Right 1016086280 6:139919367-139919389 TTGTACTTTTAGAAGAGAGATGG No data
1016086277_1016086284 14 Left 1016086277 6:139919351-139919373 CCACCACCATTTTTTTTTGTACT No data
Right 1016086284 6:139919388-139919410 GGGGTTTTGCGATATAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016086277 Original CRISPR AGTACAAAAAAAAATGGTGG TGG (reversed) Intergenic
No off target data available for this crispr