ID: 1016086280

View in Genome Browser
Species Human (GRCh38)
Location 6:139919367-139919389
Sequence TTGTACTTTTAGAAGAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016086276_1016086280 21 Left 1016086276 6:139919323-139919345 CCAGAGTAGCTGGGACTACAGGC 0: 71612
1: 190254
2: 237127
3: 179987
4: 110598
Right 1016086280 6:139919367-139919389 TTGTACTTTTAGAAGAGAGATGG No data
1016086277_1016086280 -7 Left 1016086277 6:139919351-139919373 CCACCACCATTTTTTTTTGTACT No data
Right 1016086280 6:139919367-139919389 TTGTACTTTTAGAAGAGAGATGG No data
1016086274_1016086280 24 Left 1016086274 6:139919320-139919342 CCTCCAGAGTAGCTGGGACTACA 0: 4222
1: 106815
2: 237506
3: 242608
4: 147582
Right 1016086280 6:139919367-139919389 TTGTACTTTTAGAAGAGAGATGG No data
1016086278_1016086280 -10 Left 1016086278 6:139919354-139919376 CCACCATTTTTTTTTGTACTTTT No data
Right 1016086280 6:139919367-139919389 TTGTACTTTTAGAAGAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016086280 Original CRISPR TTGTACTTTTAGAAGAGAGA TGG Intergenic
No off target data available for this crispr