ID: 1016089365

View in Genome Browser
Species Human (GRCh38)
Location 6:139957071-139957093
Sequence TTCTATATTCAGAAATTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016089363_1016089365 -3 Left 1016089363 6:139957051-139957073 CCTTAATAAATGGAGGGGTATTC No data
Right 1016089365 6:139957071-139957093 TTCTATATTCAGAAATTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016089365 Original CRISPR TTCTATATTCAGAAATTGGA TGG Intergenic
No off target data available for this crispr