ID: 1016099939

View in Genome Browser
Species Human (GRCh38)
Location 6:140086794-140086816
Sequence TTTGTAATTTGAAGTTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016099939_1016099944 5 Left 1016099939 6:140086794-140086816 CCCTGTCAACTTCAAATTACAAA No data
Right 1016099944 6:140086822-140086844 GTGCACGCTGGGGCATATGTTGG No data
1016099939_1016099941 -7 Left 1016099939 6:140086794-140086816 CCCTGTCAACTTCAAATTACAAA No data
Right 1016099941 6:140086810-140086832 TTACAAATCATAGTGCACGCTGG No data
1016099939_1016099946 25 Left 1016099939 6:140086794-140086816 CCCTGTCAACTTCAAATTACAAA No data
Right 1016099946 6:140086842-140086864 TGGGCTTCCCTTTGATTAACAGG No data
1016099939_1016099942 -6 Left 1016099939 6:140086794-140086816 CCCTGTCAACTTCAAATTACAAA No data
Right 1016099942 6:140086811-140086833 TACAAATCATAGTGCACGCTGGG No data
1016099939_1016099945 6 Left 1016099939 6:140086794-140086816 CCCTGTCAACTTCAAATTACAAA No data
Right 1016099945 6:140086823-140086845 TGCACGCTGGGGCATATGTTGGG No data
1016099939_1016099948 29 Left 1016099939 6:140086794-140086816 CCCTGTCAACTTCAAATTACAAA No data
Right 1016099948 6:140086846-140086868 CTTCCCTTTGATTAACAGGGAGG No data
1016099939_1016099947 26 Left 1016099939 6:140086794-140086816 CCCTGTCAACTTCAAATTACAAA No data
Right 1016099947 6:140086843-140086865 GGGCTTCCCTTTGATTAACAGGG No data
1016099939_1016099943 -5 Left 1016099939 6:140086794-140086816 CCCTGTCAACTTCAAATTACAAA No data
Right 1016099943 6:140086812-140086834 ACAAATCATAGTGCACGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016099939 Original CRISPR TTTGTAATTTGAAGTTGACA GGG (reversed) Intergenic
No off target data available for this crispr