ID: 1016099940

View in Genome Browser
Species Human (GRCh38)
Location 6:140086795-140086817
Sequence ATTTGTAATTTGAAGTTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016099940_1016099946 24 Left 1016099940 6:140086795-140086817 CCTGTCAACTTCAAATTACAAAT No data
Right 1016099946 6:140086842-140086864 TGGGCTTCCCTTTGATTAACAGG No data
1016099940_1016099943 -6 Left 1016099940 6:140086795-140086817 CCTGTCAACTTCAAATTACAAAT No data
Right 1016099943 6:140086812-140086834 ACAAATCATAGTGCACGCTGGGG No data
1016099940_1016099945 5 Left 1016099940 6:140086795-140086817 CCTGTCAACTTCAAATTACAAAT No data
Right 1016099945 6:140086823-140086845 TGCACGCTGGGGCATATGTTGGG No data
1016099940_1016099942 -7 Left 1016099940 6:140086795-140086817 CCTGTCAACTTCAAATTACAAAT No data
Right 1016099942 6:140086811-140086833 TACAAATCATAGTGCACGCTGGG No data
1016099940_1016099948 28 Left 1016099940 6:140086795-140086817 CCTGTCAACTTCAAATTACAAAT No data
Right 1016099948 6:140086846-140086868 CTTCCCTTTGATTAACAGGGAGG No data
1016099940_1016099944 4 Left 1016099940 6:140086795-140086817 CCTGTCAACTTCAAATTACAAAT No data
Right 1016099944 6:140086822-140086844 GTGCACGCTGGGGCATATGTTGG No data
1016099940_1016099941 -8 Left 1016099940 6:140086795-140086817 CCTGTCAACTTCAAATTACAAAT No data
Right 1016099941 6:140086810-140086832 TTACAAATCATAGTGCACGCTGG No data
1016099940_1016099947 25 Left 1016099940 6:140086795-140086817 CCTGTCAACTTCAAATTACAAAT No data
Right 1016099947 6:140086843-140086865 GGGCTTCCCTTTGATTAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016099940 Original CRISPR ATTTGTAATTTGAAGTTGAC AGG (reversed) Intergenic
No off target data available for this crispr