ID: 1016099946

View in Genome Browser
Species Human (GRCh38)
Location 6:140086842-140086864
Sequence TGGGCTTCCCTTTGATTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016099939_1016099946 25 Left 1016099939 6:140086794-140086816 CCCTGTCAACTTCAAATTACAAA No data
Right 1016099946 6:140086842-140086864 TGGGCTTCCCTTTGATTAACAGG No data
1016099940_1016099946 24 Left 1016099940 6:140086795-140086817 CCTGTCAACTTCAAATTACAAAT No data
Right 1016099946 6:140086842-140086864 TGGGCTTCCCTTTGATTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016099946 Original CRISPR TGGGCTTCCCTTTGATTAAC AGG Intergenic
No off target data available for this crispr