ID: 1016101629

View in Genome Browser
Species Human (GRCh38)
Location 6:140108551-140108573
Sequence GTCAGCTCACGTGGTACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016101629_1016101634 7 Left 1016101629 6:140108551-140108573 CCCTCTGTACCACGTGAGCTGAC No data
Right 1016101634 6:140108581-140108603 TATAGAGTACTGGGTACTCGTGG No data
1016101629_1016101632 -3 Left 1016101629 6:140108551-140108573 CCCTCTGTACCACGTGAGCTGAC No data
Right 1016101632 6:140108571-140108593 GACTGATGCTTATAGAGTACTGG No data
1016101629_1016101633 -2 Left 1016101629 6:140108551-140108573 CCCTCTGTACCACGTGAGCTGAC No data
Right 1016101633 6:140108572-140108594 ACTGATGCTTATAGAGTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016101629 Original CRISPR GTCAGCTCACGTGGTACAGA GGG (reversed) Intergenic