ID: 1016113552 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:140256156-140256178 |
| Sequence | CTATATAAAAAGGTGAAATT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1016113550_1016113552 | 9 | Left | 1016113550 | 6:140256124-140256146 | CCATCTAAAATGTGATTTATTTT | No data | ||
| Right | 1016113552 | 6:140256156-140256178 | CTATATAAAAAGGTGAAATTTGG | No data | ||||
| 1016113549_1016113552 | 26 | Left | 1016113549 | 6:140256107-140256129 | CCAGTTGTTTCTTGGATCCATCT | No data | ||
| Right | 1016113552 | 6:140256156-140256178 | CTATATAAAAAGGTGAAATTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1016113552 | Original CRISPR | CTATATAAAAAGGTGAAATT TGG | Intergenic | ||
| No off target data available for this crispr | |||||