ID: 1016113552

View in Genome Browser
Species Human (GRCh38)
Location 6:140256156-140256178
Sequence CTATATAAAAAGGTGAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016113550_1016113552 9 Left 1016113550 6:140256124-140256146 CCATCTAAAATGTGATTTATTTT No data
Right 1016113552 6:140256156-140256178 CTATATAAAAAGGTGAAATTTGG No data
1016113549_1016113552 26 Left 1016113549 6:140256107-140256129 CCAGTTGTTTCTTGGATCCATCT No data
Right 1016113552 6:140256156-140256178 CTATATAAAAAGGTGAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016113552 Original CRISPR CTATATAAAAAGGTGAAATT TGG Intergenic
No off target data available for this crispr