ID: 1016115135

View in Genome Browser
Species Human (GRCh38)
Location 6:140271963-140271985
Sequence TGGTAATCTCTATTTATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016115131_1016115135 5 Left 1016115131 6:140271935-140271957 CCTCACACTTCCTCAGGTTAAAA No data
Right 1016115135 6:140271963-140271985 TGGTAATCTCTATTTATAAATGG No data
1016115134_1016115135 -5 Left 1016115134 6:140271945-140271967 CCTCAGGTTAAAAGGTTATGGTA No data
Right 1016115135 6:140271963-140271985 TGGTAATCTCTATTTATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016115135 Original CRISPR TGGTAATCTCTATTTATAAA TGG Intergenic
No off target data available for this crispr