ID: 1016117389

View in Genome Browser
Species Human (GRCh38)
Location 6:140303776-140303798
Sequence CTGCAGAGAAGGAGAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016117389_1016117393 7 Left 1016117389 6:140303776-140303798 CCCTCTGCTCTCCTTCTCTGCAG No data
Right 1016117393 6:140303806-140303828 ACTCTTTTGCTTGTGAAGCCTGG No data
1016117389_1016117394 8 Left 1016117389 6:140303776-140303798 CCCTCTGCTCTCCTTCTCTGCAG No data
Right 1016117394 6:140303807-140303829 CTCTTTTGCTTGTGAAGCCTGGG No data
1016117389_1016117396 16 Left 1016117389 6:140303776-140303798 CCCTCTGCTCTCCTTCTCTGCAG No data
Right 1016117396 6:140303815-140303837 CTTGTGAAGCCTGGGGTTTGTGG No data
1016117389_1016117399 26 Left 1016117389 6:140303776-140303798 CCCTCTGCTCTCCTTCTCTGCAG No data
Right 1016117399 6:140303825-140303847 CTGGGGTTTGTGGTTTATATGGG No data
1016117389_1016117398 25 Left 1016117389 6:140303776-140303798 CCCTCTGCTCTCCTTCTCTGCAG No data
Right 1016117398 6:140303824-140303846 CCTGGGGTTTGTGGTTTATATGG No data
1016117389_1016117395 9 Left 1016117389 6:140303776-140303798 CCCTCTGCTCTCCTTCTCTGCAG No data
Right 1016117395 6:140303808-140303830 TCTTTTGCTTGTGAAGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016117389 Original CRISPR CTGCAGAGAAGGAGAGCAGA GGG (reversed) Intergenic
No off target data available for this crispr