ID: 1016119914

View in Genome Browser
Species Human (GRCh38)
Location 6:140332682-140332704
Sequence GACAGTTCTTGGCCTATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016119914_1016119918 16 Left 1016119914 6:140332682-140332704 CCAGTAATAGGCCAAGAACTGTC No data
Right 1016119918 6:140332721-140332743 GTTATCTGCAGAAAATGGCAAGG 0: 12
1: 195
2: 171
3: 143
4: 299
1016119914_1016119917 11 Left 1016119914 6:140332682-140332704 CCAGTAATAGGCCAAGAACTGTC No data
Right 1016119917 6:140332716-140332738 GAGTAGTTATCTGCAGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016119914 Original CRISPR GACAGTTCTTGGCCTATTAC TGG (reversed) Intergenic
No off target data available for this crispr