ID: 1016120307

View in Genome Browser
Species Human (GRCh38)
Location 6:140335908-140335930
Sequence ATTTTCCTCTAGAACAACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016120303_1016120307 11 Left 1016120303 6:140335874-140335896 CCAAAACCAACTGAAGAAATCCA No data
Right 1016120307 6:140335908-140335930 ATTTTCCTCTAGAACAACTCTGG No data
1016120299_1016120307 26 Left 1016120299 6:140335859-140335881 CCAACTCCAGAAACCCCAAAACC 0: 160
1: 165
2: 130
3: 140
4: 410
Right 1016120307 6:140335908-140335930 ATTTTCCTCTAGAACAACTCTGG No data
1016120304_1016120307 5 Left 1016120304 6:140335880-140335902 CCAACTGAAGAAATCCATCCTTA No data
Right 1016120307 6:140335908-140335930 ATTTTCCTCTAGAACAACTCTGG No data
1016120301_1016120307 13 Left 1016120301 6:140335872-140335894 CCCCAAAACCAACTGAAGAAATC No data
Right 1016120307 6:140335908-140335930 ATTTTCCTCTAGAACAACTCTGG No data
1016120305_1016120307 -9 Left 1016120305 6:140335894-140335916 CCATCCTTAAAATTATTTTCCTC No data
Right 1016120307 6:140335908-140335930 ATTTTCCTCTAGAACAACTCTGG No data
1016120302_1016120307 12 Left 1016120302 6:140335873-140335895 CCCAAAACCAACTGAAGAAATCC No data
Right 1016120307 6:140335908-140335930 ATTTTCCTCTAGAACAACTCTGG No data
1016120300_1016120307 20 Left 1016120300 6:140335865-140335887 CCAGAAACCCCAAAACCAACTGA No data
Right 1016120307 6:140335908-140335930 ATTTTCCTCTAGAACAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016120307 Original CRISPR ATTTTCCTCTAGAACAACTC TGG Intergenic
No off target data available for this crispr