ID: 1016120507

View in Genome Browser
Species Human (GRCh38)
Location 6:140337437-140337459
Sequence CAGGTGATTCTGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016120507_1016120522 21 Left 1016120507 6:140337437-140337459 CCTTCCTCCTCCAGAATCACCTG No data
Right 1016120522 6:140337481-140337503 GGTTTGAGCCATCGGAGCTGGGG No data
1016120507_1016120517 0 Left 1016120507 6:140337437-140337459 CCTTCCTCCTCCAGAATCACCTG No data
Right 1016120517 6:140337460-140337482 GGGCTCCTGGATGATAATGGTGG No data
1016120507_1016120519 13 Left 1016120507 6:140337437-140337459 CCTTCCTCCTCCAGAATCACCTG No data
Right 1016120519 6:140337473-140337495 ATAATGGTGGTTTGAGCCATCGG No data
1016120507_1016120520 19 Left 1016120507 6:140337437-140337459 CCTTCCTCCTCCAGAATCACCTG No data
Right 1016120520 6:140337479-140337501 GTGGTTTGAGCCATCGGAGCTGG No data
1016120507_1016120516 -3 Left 1016120507 6:140337437-140337459 CCTTCCTCCTCCAGAATCACCTG No data
Right 1016120516 6:140337457-140337479 CTGGGGCTCCTGGATGATAATGG No data
1016120507_1016120521 20 Left 1016120507 6:140337437-140337459 CCTTCCTCCTCCAGAATCACCTG No data
Right 1016120521 6:140337480-140337502 TGGTTTGAGCCATCGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016120507 Original CRISPR CAGGTGATTCTGGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr