ID: 1016126291

View in Genome Browser
Species Human (GRCh38)
Location 6:140408337-140408359
Sequence TTTTAGCCACAGCTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016126291_1016126302 14 Left 1016126291 6:140408337-140408359 CCCAGCTCCAGCTGTGGCTAAAA No data
Right 1016126302 6:140408374-140408396 GCTCAGGCTGTTGCTTCAGGGGG No data
1016126291_1016126300 12 Left 1016126291 6:140408337-140408359 CCCAGCTCCAGCTGTGGCTAAAA No data
Right 1016126300 6:140408372-140408394 CAGCTCAGGCTGTTGCTTCAGGG No data
1016126291_1016126297 -2 Left 1016126291 6:140408337-140408359 CCCAGCTCCAGCTGTGGCTAAAA No data
Right 1016126297 6:140408358-140408380 AAGGGGCCAAGCTACAGCTCAGG No data
1016126291_1016126301 13 Left 1016126291 6:140408337-140408359 CCCAGCTCCAGCTGTGGCTAAAA No data
Right 1016126301 6:140408373-140408395 AGCTCAGGCTGTTGCTTCAGGGG 0: 147
1: 457
2: 898
3: 1288
4: 1398
1016126291_1016126299 11 Left 1016126291 6:140408337-140408359 CCCAGCTCCAGCTGTGGCTAAAA No data
Right 1016126299 6:140408371-140408393 ACAGCTCAGGCTGTTGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016126291 Original CRISPR TTTTAGCCACAGCTGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr