ID: 1016126707

View in Genome Browser
Species Human (GRCh38)
Location 6:140412397-140412419
Sequence GACTTTGATTGAGGGGCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016126707_1016126713 23 Left 1016126707 6:140412397-140412419 CCTTATGCCCCTCAATCAAAGTC No data
Right 1016126713 6:140412443-140412465 GAGGTTGCTGCAGACCTGTATGG 0: 43
1: 89
2: 175
3: 232
4: 329
1016126707_1016126712 4 Left 1016126707 6:140412397-140412419 CCTTATGCCCCTCAATCAAAGTC No data
Right 1016126712 6:140412424-140412446 TTCTCAGAAGGCAAGAATCGAGG No data
1016126707_1016126711 -8 Left 1016126707 6:140412397-140412419 CCTTATGCCCCTCAATCAAAGTC No data
Right 1016126711 6:140412412-140412434 TCAAAGTCTTTCTTCTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016126707 Original CRISPR GACTTTGATTGAGGGGCATA AGG (reversed) Intergenic
No off target data available for this crispr