ID: 1016132838

View in Genome Browser
Species Human (GRCh38)
Location 6:140497997-140498019
Sequence AACAGCTCTTGGCCTGTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016132838_1016132841 8 Left 1016132838 6:140497997-140498019 CCAATTACAGGCCAAGAGCTGTT No data
Right 1016132841 6:140498028-140498050 AGGAGAATAGTTATCTGCAGAGG No data
1016132838_1016132842 12 Left 1016132838 6:140497997-140498019 CCAATTACAGGCCAAGAGCTGTT No data
Right 1016132842 6:140498032-140498054 GAATAGTTATCTGCAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016132838 Original CRISPR AACAGCTCTTGGCCTGTAAT TGG (reversed) Intergenic
No off target data available for this crispr