ID: 1016133210

View in Genome Browser
Species Human (GRCh38)
Location 6:140503231-140503253
Sequence CAGAGTAAATAGAAAGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016133205_1016133210 18 Left 1016133205 6:140503190-140503212 CCACAGAGGAGGGAATGGGGTTT No data
Right 1016133210 6:140503231-140503253 CAGAGTAAATAGAAAGAGGTGGG No data
1016133207_1016133210 -6 Left 1016133207 6:140503214-140503236 CCAATATTTAGTGGAAACAGAGT No data
Right 1016133210 6:140503231-140503253 CAGAGTAAATAGAAAGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016133210 Original CRISPR CAGAGTAAATAGAAAGAGGT GGG Intergenic
No off target data available for this crispr