ID: 1016135644

View in Genome Browser
Species Human (GRCh38)
Location 6:140538690-140538712
Sequence TTTTCAATGGGGAAAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016135644_1016135651 17 Left 1016135644 6:140538690-140538712 CCTGCCTTTTTCCCCATTGAAAA No data
Right 1016135651 6:140538730-140538752 ATTTATATAGCTCATTATTTTGG No data
1016135644_1016135652 23 Left 1016135644 6:140538690-140538712 CCTGCCTTTTTCCCCATTGAAAA No data
Right 1016135652 6:140538736-140538758 ATAGCTCATTATTTTGGACCTGG No data
1016135644_1016135653 24 Left 1016135644 6:140538690-140538712 CCTGCCTTTTTCCCCATTGAAAA No data
Right 1016135653 6:140538737-140538759 TAGCTCATTATTTTGGACCTGGG No data
1016135644_1016135654 25 Left 1016135644 6:140538690-140538712 CCTGCCTTTTTCCCCATTGAAAA No data
Right 1016135654 6:140538738-140538760 AGCTCATTATTTTGGACCTGGGG No data
1016135644_1016135649 -8 Left 1016135644 6:140538690-140538712 CCTGCCTTTTTCCCCATTGAAAA No data
Right 1016135649 6:140538705-140538727 ATTGAAAAATAGTCCTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016135644 Original CRISPR TTTTCAATGGGGAAAAAGGC AGG (reversed) Intergenic
No off target data available for this crispr