ID: 1016153377

View in Genome Browser
Species Human (GRCh38)
Location 6:140772170-140772192
Sequence TCTCCAGGACAACACCAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016153372_1016153377 0 Left 1016153372 6:140772147-140772169 CCAGATCTCACAGTAACTCACTC No data
Right 1016153377 6:140772170-140772192 TCTCCAGGACAACACCAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016153377 Original CRISPR TCTCCAGGACAACACCAAGG GGG Intergenic
No off target data available for this crispr