ID: 1016153856

View in Genome Browser
Species Human (GRCh38)
Location 6:140780103-140780125
Sequence CTGACAGGGGATGGGGAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016153856_1016153871 17 Left 1016153856 6:140780103-140780125 CCCCATTCCCCATCCCCTGTCAG No data
Right 1016153871 6:140780143-140780165 GGGCGCGTTTCTGTGCACTAGGG No data
1016153856_1016153868 -3 Left 1016153856 6:140780103-140780125 CCCCATTCCCCATCCCCTGTCAG No data
Right 1016153868 6:140780123-140780145 CAGCCACAGTATGGTGCAAGGGG No data
1016153856_1016153866 -5 Left 1016153856 6:140780103-140780125 CCCCATTCCCCATCCCCTGTCAG No data
Right 1016153866 6:140780121-140780143 GTCAGCCACAGTATGGTGCAAGG No data
1016153856_1016153867 -4 Left 1016153856 6:140780103-140780125 CCCCATTCCCCATCCCCTGTCAG No data
Right 1016153867 6:140780122-140780144 TCAGCCACAGTATGGTGCAAGGG No data
1016153856_1016153870 16 Left 1016153856 6:140780103-140780125 CCCCATTCCCCATCCCCTGTCAG No data
Right 1016153870 6:140780142-140780164 GGGGCGCGTTTCTGTGCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016153856 Original CRISPR CTGACAGGGGATGGGGAATG GGG (reversed) Intergenic
No off target data available for this crispr