ID: 1016153867

View in Genome Browser
Species Human (GRCh38)
Location 6:140780122-140780144
Sequence TCAGCCACAGTATGGTGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016153857_1016153867 -5 Left 1016153857 6:140780104-140780126 CCCATTCCCCATCCCCTGTCAGC No data
Right 1016153867 6:140780122-140780144 TCAGCCACAGTATGGTGCAAGGG No data
1016153855_1016153867 -3 Left 1016153855 6:140780102-140780124 CCCCCATTCCCCATCCCCTGTCA No data
Right 1016153867 6:140780122-140780144 TCAGCCACAGTATGGTGCAAGGG No data
1016153858_1016153867 -6 Left 1016153858 6:140780105-140780127 CCATTCCCCATCCCCTGTCAGCC No data
Right 1016153867 6:140780122-140780144 TCAGCCACAGTATGGTGCAAGGG No data
1016153856_1016153867 -4 Left 1016153856 6:140780103-140780125 CCCCATTCCCCATCCCCTGTCAG No data
Right 1016153867 6:140780122-140780144 TCAGCCACAGTATGGTGCAAGGG No data
1016153854_1016153867 -2 Left 1016153854 6:140780101-140780123 CCCCCCATTCCCCATCCCCTGTC No data
Right 1016153867 6:140780122-140780144 TCAGCCACAGTATGGTGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016153867 Original CRISPR TCAGCCACAGTATGGTGCAA GGG Intergenic
No off target data available for this crispr