ID: 1016153870

View in Genome Browser
Species Human (GRCh38)
Location 6:140780142-140780164
Sequence GGGGCGCGTTTCTGTGCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016153869_1016153870 -7 Left 1016153869 6:140780126-140780148 CCACAGTATGGTGCAAGGGGCGC No data
Right 1016153870 6:140780142-140780164 GGGGCGCGTTTCTGTGCACTAGG No data
1016153854_1016153870 18 Left 1016153854 6:140780101-140780123 CCCCCCATTCCCCATCCCCTGTC No data
Right 1016153870 6:140780142-140780164 GGGGCGCGTTTCTGTGCACTAGG No data
1016153859_1016153870 9 Left 1016153859 6:140780110-140780132 CCCCATCCCCTGTCAGCCACAGT No data
Right 1016153870 6:140780142-140780164 GGGGCGCGTTTCTGTGCACTAGG No data
1016153858_1016153870 14 Left 1016153858 6:140780105-140780127 CCATTCCCCATCCCCTGTCAGCC No data
Right 1016153870 6:140780142-140780164 GGGGCGCGTTTCTGTGCACTAGG No data
1016153857_1016153870 15 Left 1016153857 6:140780104-140780126 CCCATTCCCCATCCCCTGTCAGC No data
Right 1016153870 6:140780142-140780164 GGGGCGCGTTTCTGTGCACTAGG No data
1016153861_1016153870 7 Left 1016153861 6:140780112-140780134 CCATCCCCTGTCAGCCACAGTAT No data
Right 1016153870 6:140780142-140780164 GGGGCGCGTTTCTGTGCACTAGG No data
1016153855_1016153870 17 Left 1016153855 6:140780102-140780124 CCCCCATTCCCCATCCCCTGTCA No data
Right 1016153870 6:140780142-140780164 GGGGCGCGTTTCTGTGCACTAGG No data
1016153863_1016153870 3 Left 1016153863 6:140780116-140780138 CCCCTGTCAGCCACAGTATGGTG No data
Right 1016153870 6:140780142-140780164 GGGGCGCGTTTCTGTGCACTAGG No data
1016153856_1016153870 16 Left 1016153856 6:140780103-140780125 CCCCATTCCCCATCCCCTGTCAG No data
Right 1016153870 6:140780142-140780164 GGGGCGCGTTTCTGTGCACTAGG No data
1016153864_1016153870 2 Left 1016153864 6:140780117-140780139 CCCTGTCAGCCACAGTATGGTGC No data
Right 1016153870 6:140780142-140780164 GGGGCGCGTTTCTGTGCACTAGG No data
1016153865_1016153870 1 Left 1016153865 6:140780118-140780140 CCTGTCAGCCACAGTATGGTGCA No data
Right 1016153870 6:140780142-140780164 GGGGCGCGTTTCTGTGCACTAGG No data
1016153860_1016153870 8 Left 1016153860 6:140780111-140780133 CCCATCCCCTGTCAGCCACAGTA No data
Right 1016153870 6:140780142-140780164 GGGGCGCGTTTCTGTGCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016153870 Original CRISPR GGGGCGCGTTTCTGTGCACT AGG Intergenic
No off target data available for this crispr