ID: 1016154044

View in Genome Browser
Species Human (GRCh38)
Location 6:140781182-140781204
Sequence CTGTGGTGGTGGAGGCCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016154032_1016154044 22 Left 1016154032 6:140781137-140781159 CCTTAAGGGAACATGGGCAGTAG No data
Right 1016154044 6:140781182-140781204 CTGTGGTGGTGGAGGCCACAAGG No data
1016154029_1016154044 29 Left 1016154029 6:140781130-140781152 CCTTGGGCCTTAAGGGAACATGG 0: 8
1: 37
2: 164
3: 384
4: 921
Right 1016154044 6:140781182-140781204 CTGTGGTGGTGGAGGCCACAAGG No data
1016154028_1016154044 30 Left 1016154028 6:140781129-140781151 CCCTTGGGCCTTAAGGGAACATG 0: 3
1: 53
2: 150
3: 379
4: 591
Right 1016154044 6:140781182-140781204 CTGTGGTGGTGGAGGCCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016154044 Original CRISPR CTGTGGTGGTGGAGGCCACA AGG Intergenic
No off target data available for this crispr