ID: 1016154184

View in Genome Browser
Species Human (GRCh38)
Location 6:140783237-140783259
Sequence AAGAGCTATCTTTGTTTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016154184_1016154187 15 Left 1016154184 6:140783237-140783259 CCTGATAAACAAAGATAGCTCTT No data
Right 1016154187 6:140783275-140783297 ATTGAGTGTAACAAGAGGGAAGG No data
1016154184_1016154186 11 Left 1016154184 6:140783237-140783259 CCTGATAAACAAAGATAGCTCTT No data
Right 1016154186 6:140783271-140783293 GTACATTGAGTGTAACAAGAGGG No data
1016154184_1016154188 18 Left 1016154184 6:140783237-140783259 CCTGATAAACAAAGATAGCTCTT No data
Right 1016154188 6:140783278-140783300 GAGTGTAACAAGAGGGAAGGAGG No data
1016154184_1016154185 10 Left 1016154184 6:140783237-140783259 CCTGATAAACAAAGATAGCTCTT No data
Right 1016154185 6:140783270-140783292 TGTACATTGAGTGTAACAAGAGG No data
1016154184_1016154189 19 Left 1016154184 6:140783237-140783259 CCTGATAAACAAAGATAGCTCTT No data
Right 1016154189 6:140783279-140783301 AGTGTAACAAGAGGGAAGGAGGG No data
1016154184_1016154190 22 Left 1016154184 6:140783237-140783259 CCTGATAAACAAAGATAGCTCTT No data
Right 1016154190 6:140783282-140783304 GTAACAAGAGGGAAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016154184 Original CRISPR AAGAGCTATCTTTGTTTATC AGG (reversed) Intergenic
No off target data available for this crispr