ID: 1016154188

View in Genome Browser
Species Human (GRCh38)
Location 6:140783278-140783300
Sequence GAGTGTAACAAGAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016154183_1016154188 28 Left 1016154183 6:140783227-140783249 CCTATGCTGACCTGATAAACAAA No data
Right 1016154188 6:140783278-140783300 GAGTGTAACAAGAGGGAAGGAGG No data
1016154184_1016154188 18 Left 1016154184 6:140783237-140783259 CCTGATAAACAAAGATAGCTCTT No data
Right 1016154188 6:140783278-140783300 GAGTGTAACAAGAGGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016154188 Original CRISPR GAGTGTAACAAGAGGGAAGG AGG Intergenic
No off target data available for this crispr