ID: 1016157003

View in Genome Browser
Species Human (GRCh38)
Location 6:140823194-140823216
Sequence ATATATTAATAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016157003_1016157010 -1 Left 1016157003 6:140823194-140823216 CCCTCTTCCCTCTATTAATATAT No data
Right 1016157010 6:140823216-140823238 TGGGCAGCATATAAAACCATGGG No data
1016157003_1016157013 29 Left 1016157003 6:140823194-140823216 CCCTCTTCCCTCTATTAATATAT No data
Right 1016157013 6:140823246-140823268 AAGGTAAATTTCTTACTTCCTGG No data
1016157003_1016157011 10 Left 1016157003 6:140823194-140823216 CCCTCTTCCCTCTATTAATATAT No data
Right 1016157011 6:140823227-140823249 TAAAACCATGGGTGTAGACAAGG No data
1016157003_1016157009 -2 Left 1016157003 6:140823194-140823216 CCCTCTTCCCTCTATTAATATAT No data
Right 1016157009 6:140823215-140823237 ATGGGCAGCATATAAAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016157003 Original CRISPR ATATATTAATAGAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr