ID: 1016157007

View in Genome Browser
Species Human (GRCh38)
Location 6:140823201-140823223
Sequence GCTGCCCATATATTAATAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016157007_1016157011 3 Left 1016157007 6:140823201-140823223 CCCTCTATTAATATATGGGCAGC No data
Right 1016157011 6:140823227-140823249 TAAAACCATGGGTGTAGACAAGG No data
1016157007_1016157010 -8 Left 1016157007 6:140823201-140823223 CCCTCTATTAATATATGGGCAGC No data
Right 1016157010 6:140823216-140823238 TGGGCAGCATATAAAACCATGGG No data
1016157007_1016157013 22 Left 1016157007 6:140823201-140823223 CCCTCTATTAATATATGGGCAGC No data
Right 1016157013 6:140823246-140823268 AAGGTAAATTTCTTACTTCCTGG No data
1016157007_1016157009 -9 Left 1016157007 6:140823201-140823223 CCCTCTATTAATATATGGGCAGC No data
Right 1016157009 6:140823215-140823237 ATGGGCAGCATATAAAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016157007 Original CRISPR GCTGCCCATATATTAATAGA GGG (reversed) Intergenic
No off target data available for this crispr