ID: 1016157010

View in Genome Browser
Species Human (GRCh38)
Location 6:140823216-140823238
Sequence TGGGCAGCATATAAAACCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016157007_1016157010 -8 Left 1016157007 6:140823201-140823223 CCCTCTATTAATATATGGGCAGC No data
Right 1016157010 6:140823216-140823238 TGGGCAGCATATAAAACCATGGG No data
1016157008_1016157010 -9 Left 1016157008 6:140823202-140823224 CCTCTATTAATATATGGGCAGCA No data
Right 1016157010 6:140823216-140823238 TGGGCAGCATATAAAACCATGGG No data
1016157002_1016157010 4 Left 1016157002 6:140823189-140823211 CCTCTCCCTCTTCCCTCTATTAA No data
Right 1016157010 6:140823216-140823238 TGGGCAGCATATAAAACCATGGG No data
1016157004_1016157010 -2 Left 1016157004 6:140823195-140823217 CCTCTTCCCTCTATTAATATATG No data
Right 1016157010 6:140823216-140823238 TGGGCAGCATATAAAACCATGGG No data
1016157003_1016157010 -1 Left 1016157003 6:140823194-140823216 CCCTCTTCCCTCTATTAATATAT No data
Right 1016157010 6:140823216-140823238 TGGGCAGCATATAAAACCATGGG No data
1016157001_1016157010 5 Left 1016157001 6:140823188-140823210 CCCTCTCCCTCTTCCCTCTATTA No data
Right 1016157010 6:140823216-140823238 TGGGCAGCATATAAAACCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016157010 Original CRISPR TGGGCAGCATATAAAACCAT GGG Intergenic
No off target data available for this crispr