ID: 1016157012

View in Genome Browser
Species Human (GRCh38)
Location 6:140823232-140823254
Sequence ATTTACCTTGTCTACACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016157012_1016157014 1 Left 1016157012 6:140823232-140823254 CCATGGGTGTAGACAAGGTAAAT No data
Right 1016157014 6:140823256-140823278 TCTTACTTCCTGGAGACAACTGG No data
1016157012_1016157015 2 Left 1016157012 6:140823232-140823254 CCATGGGTGTAGACAAGGTAAAT No data
Right 1016157015 6:140823257-140823279 CTTACTTCCTGGAGACAACTGGG No data
1016157012_1016157013 -9 Left 1016157012 6:140823232-140823254 CCATGGGTGTAGACAAGGTAAAT No data
Right 1016157013 6:140823246-140823268 AAGGTAAATTTCTTACTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016157012 Original CRISPR ATTTACCTTGTCTACACCCA TGG (reversed) Intergenic
No off target data available for this crispr