ID: 1016157013

View in Genome Browser
Species Human (GRCh38)
Location 6:140823246-140823268
Sequence AAGGTAAATTTCTTACTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016157012_1016157013 -9 Left 1016157012 6:140823232-140823254 CCATGGGTGTAGACAAGGTAAAT No data
Right 1016157013 6:140823246-140823268 AAGGTAAATTTCTTACTTCCTGG No data
1016157003_1016157013 29 Left 1016157003 6:140823194-140823216 CCCTCTTCCCTCTATTAATATAT No data
Right 1016157013 6:140823246-140823268 AAGGTAAATTTCTTACTTCCTGG No data
1016157008_1016157013 21 Left 1016157008 6:140823202-140823224 CCTCTATTAATATATGGGCAGCA No data
Right 1016157013 6:140823246-140823268 AAGGTAAATTTCTTACTTCCTGG No data
1016157007_1016157013 22 Left 1016157007 6:140823201-140823223 CCCTCTATTAATATATGGGCAGC No data
Right 1016157013 6:140823246-140823268 AAGGTAAATTTCTTACTTCCTGG No data
1016157004_1016157013 28 Left 1016157004 6:140823195-140823217 CCTCTTCCCTCTATTAATATATG No data
Right 1016157013 6:140823246-140823268 AAGGTAAATTTCTTACTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016157013 Original CRISPR AAGGTAAATTTCTTACTTCC TGG Intergenic
No off target data available for this crispr