ID: 1016158556

View in Genome Browser
Species Human (GRCh38)
Location 6:140845780-140845802
Sequence AGAGCTATGTGAGGTGTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016158553_1016158556 23 Left 1016158553 6:140845734-140845756 CCATTGAACCACATATTTGGAGA No data
Right 1016158556 6:140845780-140845802 AGAGCTATGTGAGGTGTGTTAGG No data
1016158554_1016158556 15 Left 1016158554 6:140845742-140845764 CCACATATTTGGAGAGAAGAAAA No data
Right 1016158556 6:140845780-140845802 AGAGCTATGTGAGGTGTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016158556 Original CRISPR AGAGCTATGTGAGGTGTGTT AGG Intergenic
No off target data available for this crispr