ID: 1016159607

View in Genome Browser
Species Human (GRCh38)
Location 6:140862012-140862034
Sequence CATGCCACTGAACTCGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016159605_1016159607 12 Left 1016159605 6:140861977-140861999 CCACCGAGGAGGTTGAGGCTGCA No data
Right 1016159607 6:140862012-140862034 CATGCCACTGAACTCGAGCCAGG No data
1016159606_1016159607 9 Left 1016159606 6:140861980-140862002 CCGAGGAGGTTGAGGCTGCAATA 0: 37
1: 669
2: 6916
3: 25376
4: 73825
Right 1016159607 6:140862012-140862034 CATGCCACTGAACTCGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016159607 Original CRISPR CATGCCACTGAACTCGAGCC AGG Intergenic
No off target data available for this crispr