ID: 1016166061

View in Genome Browser
Species Human (GRCh38)
Location 6:140945122-140945144
Sequence CTGTGAAAGCAGCAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016166056_1016166061 9 Left 1016166056 6:140945090-140945112 CCCTAGAAAAGCTACAGACACTC No data
Right 1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG No data
1016166055_1016166061 28 Left 1016166055 6:140945071-140945093 CCAACAGCTCGAACTGTGTCCCT No data
Right 1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG No data
1016166057_1016166061 8 Left 1016166057 6:140945091-140945113 CCTAGAAAAGCTACAGACACTCA No data
Right 1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016166061 Original CRISPR CTGTGAAAGCAGCAGGAGGA AGG Intergenic
No off target data available for this crispr