ID: 1016166503

View in Genome Browser
Species Human (GRCh38)
Location 6:140951958-140951980
Sequence TTGAATTATATCCAGGGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016166503_1016166509 29 Left 1016166503 6:140951958-140951980 CCAAACCCCTGGATATAATTCAA No data
Right 1016166509 6:140952010-140952032 GTTTTTCAAAATATGATTTTTGG No data
1016166503_1016166507 7 Left 1016166503 6:140951958-140951980 CCAAACCCCTGGATATAATTCAA No data
Right 1016166507 6:140951988-140952010 TATTTTACTTGACAGATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016166503 Original CRISPR TTGAATTATATCCAGGGGTT TGG (reversed) Intergenic
No off target data available for this crispr